Review



analog 30  (Molecular Dynamics Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Molecular Dynamics Inc analog 30
    Analog 30, supplied by Molecular Dynamics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pm42287230-178-1-42?v=Molecular+Dynamics+Inc
    Average 86 stars, based on 1 article reviews
    analog 30 - by Bioz Stars, 2026-07
    86/100 stars

    Images



    Similar Products

    30 o me m7gpppg anti reverse cap analog arca new england biolabs  (New England Biolabs)
    95
    New England Biolabs 30 o me m7gpppg anti reverse cap analog arca new england biolabs
    30 O Me M7gpppg Anti Reverse Cap Analog Arca New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pm38444607-217-0-5?v=New+England+Biolabs
    Average 95 stars, based on 1 article reviews
    30 o me m7gpppg anti reverse cap analog arca new england biolabs - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    analog 30  (Molecular Dynamics Inc)
    86
    Molecular Dynamics Inc analog 30
    Analog 30, supplied by Molecular Dynamics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pm42287230-178-1-42?v=Molecular+Dynamics+Inc
    Average 86 stars, based on 1 article reviews
    analog 30 - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    30 ghz analog signal generator e8257d  (Keysight Technologies)
    90
    Keysight Technologies 30 ghz analog signal generator e8257d
    30 Ghz Analog Signal Generator E8257d, supplied by Keysight Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pmc11336070-129-27-31?v=Keysight+Technologies
    Average 90 stars, based on 1 article reviews
    30 ghz analog signal generator e8257d - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    analog pendulum hammer pw 30-e  (Werke GmbH)
    90
    Werke GmbH analog pendulum hammer pw 30-e
    Analog Pendulum Hammer Pw 30 E, supplied by Werke GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/10__1016_slash_j__actamat__2024__120326-117-18-24?v=Werke+GmbH
    Average 90 stars, based on 1 article reviews
    analog pendulum hammer pw 30-e - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic from  (Synthego Inc)
    90
    Synthego Inc 20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic from
    20 O Methyl Analog And 30 Phosphorothioate Internucleotide Modified Sgrna Synthetic From, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pm38341433-277-6-18?v=Synthego+Inc
    Average 90 stars, based on 1 article reviews
    20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic from - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic ugaacugagucgcuauccag  (Synthego Inc)
    90
    Synthego Inc 20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic ugaacugagucgcuauccag
    20 O Methyl Analog And 30 Phosphorothioate Internucleotide Modified Sgrna Synthetic Ugaacugagucgcuauccag, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pmc10858947-293-6-19?v=Synthego+Inc
    Average 90 stars, based on 1 article reviews
    20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic ugaacugagucgcuauccag - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    cap1 analog cleancap ag (30 ome)  (TriLink)
    90
    TriLink cap1 analog cleancap ag (30 ome)
    Cap1 Analog Cleancap Ag (30 Ome), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/10__1016_slash_j__apsb__2023__11__003-84-29-31?v=TriLink
    Average 90 stars, based on 1 article reviews
    cap1 analog cleancap ag (30 ome) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    cleancap analogs ag, gg, ag-30-ch3 and gg-30-ch3  (TriLink)
    90
    TriLink cleancap analogs ag, gg, ag-30-ch3 and gg-30-ch3
    Cleancap Analogs Ag, Gg, Ag 30 Ch3 And Gg 30 Ch3, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pm35988718-150-137-113?v=TriLink
    Average 90 stars, based on 1 article reviews
    cleancap analogs ag, gg, ag-30-ch3 and gg-30-ch3 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    analog-to-digital converter powerlab r8/30  (POWERLAB INC)
    90
    POWERLAB INC analog-to-digital converter powerlab r8/30
    Analog To Digital Converter Powerlab R8/30, supplied by POWERLAB INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/10__1113_slash_jp285203-133-6-8?v=POWERLAB+INC
    Average 90 stars, based on 1 article reviews
    analog-to-digital converter powerlab r8/30 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    30 o me m7g 50 ppp 50 g rna cap structure analog  (New England Biolabs)
    93
    New England Biolabs 30 o me m7g 50 ppp 50 g rna cap structure analog
    30 O Me M7g 50 Ppp 50 G Rna Cap Structure Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analog+30/pmc10462787__mmc3-166-6-11?v=New+England+Biolabs
    Average 93 stars, based on 1 article reviews
    30 o me m7g 50 ppp 50 g rna cap structure analog - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier

    Image Search Results